Product Class: Other

Control LAMP Primer Mix (rActin)


Catalog #S0164

Product Introduction

  • Provided at 10X concentration
  • Optimized mix of 6 primers (F3, B3, FIP, BIP, LF, LB) targets actin RNA at an exon-exon junction
  • Can be used in a LAMP control reaction to verify assay and reagent performance
  • Internal control component in the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (NEB #E2019)
  • Information on using this product to detect SARS-CoV-2 viral RNA using WarmStart LAMP reagents with UDG can be viewed here
  • Need assistance designing your own LAMP primers? Use the NEB LAMP Primer Design Tool
  • Learn more about LAMP and other isothermal amplification methods
  • A publication by members of the global LAMP (gLAMP) Consortium provides a comprehensive review of LAMP and its role in the COVID-19 pandemic
 

Product Information

Description

The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a primer set (F3, B3, FIP, BIP, LF, LB) that amplifies rActin and can be used to confirm the activity of reagents, proper sample handling and the presence of human nucleic acid template in a LAMP reaction.

This product serves as an internal control primer set in the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (NEB #E2019).

Control LAMP Primer Sequences: rActin (5´→ 3´)

rActin Primer Set Sequence
ACTB-F3 AGTACCCCATCGAGCACG
ACTB-B3 AGCCTGGATAGCAACGTACA
ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA
ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC
ACTB-LF TGTGGTGCCAGATTTTCTCCA
ACTB-LB CGAGAAGATGACCCAGATCATGT

 

This product is related to the following categories:
Isothermal Amplification & Strand Displacement,
PCR, qPCR & Amplification Technologies,
This product can be used in the following applications:
Isothermal Amplification,
DNA Amplification, PCR & qPCR

Reagents Supplied

Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration

Properties & Usage

Features

  • Optimized mixture of 2 primer sets for enhanced speed and sensitivity of SARS-CoV-2 viral RNA detection
  • Information on using this product to detect SARS-CoV-2 viral RNA using WarmStart LAMP reagents with UDG can be viewed here
  • View the protocol for recommended reaction setup

 

Protocols, Manuals & Usage

Protocols

  1. Overview of Reaction Setup (NEB #S0164)

FAQs & Troubleshooting

FAQs

  1. In the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit, what is the target of the Internal Control Primer Mix (rActin)?
  2. My SARS-CoV-2 sample or Internal Control reaction turned orange/yellow upon sample addition. Does that mean that the sample contains nucleic acid?
  3. Does pre-heating the thermal block impact LAMP amplification reactions?

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.