Product Class: Restriction Endonuclease

I-CeuI
neb31 recombinant dil_B 37 65 Heat

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA

Product Introduction

  • 100% activity in rCutSmart Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Catalog # Size Concentration
R0699S 500 units 5000 units/ml
R0699L 2500 units 5000 units/ml

Product Information

Description

The intron encoding I-CeuI is present in the chloroplast large rRNA gene of Chlamydomonas eugametos (1). This gene has been cloned and overexpressed in E. coli (2).

Product Source

An E. coli strain that carries the I-CeuI gene from Chlamydomonas eugametos (C. Lemieux).
This product is related to the following categories:
Homing Endonucleases,
Restriction Endonucleases H M,
This product can be used in the following applications:
Restriction Enzyme Digestion

Reagents Supplied

Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration

Properties & Usage

Unit Definition

One unit is defined as the amount of enzyme required to cleave 1 µg of pBHS ScaI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 µl.

Reaction Conditions

1X rCutSmart™ Buffer
Incubate at 37°C

1X rCutSmart™ Buffer
50 mM Potassium Acetate
20 mM Tris-acetate
10 mM Magnesium Acetate
100 µg/ml Recombinant Albumin
(pH 7.9 @ 25°C)

Activity in NEBuffers

NEBuffer™ r1.1: 10%
NEBuffer™ r2.1: 10%
NEBuffer™ r3.1: 10%
rCutSmart™ Buffer: 100%

Diluent Compatibility

Storage Buffer

10 mM Tris-HCl
300 mM NaCl
1 mM DTT
0.1 mM EDTA
500 µg/ml BSA
50% Glycerol
pH 7.4 @ 25°C

Heat Inactivation

65°C for 20 minutes

Product Notes

  1. I-CeuI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
  2. Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  3. Supplied with plasmid DNA. ScaI-linearized pBHS is supplied at 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.5 kb plasmid gives fragments of 2100 and 1400 base pairs.
  4. Note that this enzyme requires a 3-hour incubation time.

Protocols, Manuals & Usage

Usage & Guidelines

Tools & Resources

Selection Charts

Web Tools

FAQs & Troubleshooting

FAQs

  1. Can a double digest be performed with PI-SceI and I-CeuI?
  2. I tested your restriction enzyme on the substrate DNA recommended by NEB, and it appears to be active, however it does not digest my DNA. What could be the reason?
  3. Can you tell me more about the switch from BSA to Recombinant Albumin (rAlbumin) in NEBuffers?

Troubleshooting

Tech Tips

I-CeuI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]


Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.