EpiMark® N6-Methyladenosine Enrichment Kit
Product informationCode | Name | Size | Quantity | Price | |
---|---|---|---|---|---|
E1610S |
Epimark N6-Methyladenosine Enrichment Kit |
20 rxns | - | Unavailable in your region |
EpiMark® N6-Methyladenosine Enrichment Kit
The Epimark® N6-Methyladenosine Enrichment Kit can be used to enrich m6A modified RNA in immunoprecipitation protocols for downstream analysis by next-generation RNA sequencing or RT-qPCR.
- Complete protocol for enrichment of m6A-modified –RNA and analysis by RT- qPCR included
- RNA controls (m6A modified and unmodified RNA) enable monitoring of enrichment and depletion
- Antibody supplied in a ready-to-use solution form
Featured Video
-
Product Information
The EpiMark N6-Methyladenosine Enrichment Kit contains a rabbit monoclonal antibody specific for N6-Methyladenosine (m6A). The kit also contains two control RNAs, one with m6A modification (Gaussia luciferase) and one without (Cypridina luciferase) to monitor enrichment and depletion. The GLuc RNA control was transcribed in the presence of 20% m6ATP and 80% ATP.
This kit can be used to enrich m6A modified RNA in immunoprecipitation protocols for downstream analysis by next-generation RNA sequencing or RT-qPCR. Modified RNA is isolated from a fragmented RNA sample by binding to the N6-Methyladenosine antibody attached to Protein G Magnetic Beads. After multiple wash and clean-up steps, the enriched RNA is eluted in nuclease-free water and is ready for further analysis.
Figure 1. Workflow
Each kit contains sufficient reagents to perform 10 x 2-round immunoprecipitations with starting amounts of up to 250 µg of ribosome depleted or poly A+ purified RNA. It contains sufficient reagents for 5 x 2-round immunoprecipitations when using up to 250 µg of total RNA.- This product is related to the following categories:
- Enrichment,
- Epitranscriptome Analysis,
- Methylome Analysis,
- DNA Methylation Analysis,
- RNA Modification, Next Generation Sequencing Library Preparation
-
Kit Components
The following reagents are supplied with this product:
NEB # Component Name Component # Stored at (°C) Amount Concentration -
Properties & Usage
Materials Required but not Supplied
Reaction Buffer
(150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40 in nuclease free H2O)
Protein G Magnetic Beads (NEB #S1430)
Magnetic Racks for bead separations (NEB #S1506 or #S1509)
Monarch® RNA Cleanup Kit (10 µg) (NEB #T2030)
100% Ethanol
70% Ethanol
Eppendorf® RNA/DNA LoBind microcentrifuge tubes (Sigma catalog #Z666548) or equivalent
RNase-free pipette tips
Powder-free gloves
Nuclease-free water
Optional Materials
Primers for amplification of control RNAs:
GLuc Forward Primer = 5´- CGACATTCCTGAGATTCCTGG - 3´
GLuc Reverse Primer = 5´- TTGAGCAGGTCAGAACACTG - 3´
CLuc Forward Primer = 5´- GCTTCAACATCACCGTCATTG - 3´
CLuc Reverse Primer = 5´- CACAGAGGCCAGAGATCATTC - 3´
ProtoScript® II First Strand cDNA Synthesis Kit (NEB #E6560)
Bio-Rad iTaq™ Universal SYBR® Green Supermix (cat. #172-5120)
384 well PCR plate (Bio-Rad cat. #HSP-3805)
Optical film (Bio-Rad cat. #MSB-1001) -
Related Products
-
References
- Schwartz, S. et al. (2013). Cell. 155, 1409-1421.
- Slobodin, B. et al. (2017). Cell. 169, Issue 2, 326–337. PubMedID: 28388414,
-
Protocols, Manuals & Usage
-
Manuals
The Product Manual includes details for how to use the product, as well as details of its formulation and quality controls.
-
-
FAQs & Troubleshooting
-
FAQs
- How much of the control RNAs should I use if I want to spike them into my sample?
- Will the antibody bind m6A-containing DNA?
- What is the protein concentration of the N6-Methyladenosine Antibody?
- I did not get enough yield of RNA for my downstream application after two rounds of IP. How do I increase the yield?
- What method do you recommend for RNA fragmentation?
-
-
Citations & Technical Literature
-
Citations
Product Citation Tool
-
-
Quality, Safety & Legal
-
Quality Control Assays
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here. -
Specifications & Change Notifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version] -
Certificate of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]- E1610S_v1_10013488
- E1610S_v1_10013489
- E1610S_v1_10036647
- E1610S_v1_10044381
- E1610S_v1_10054222
- E1610S_v1_10065122
- E1610S_v1_10084115
- E1610S_v1_10097225
- E1610S_v1_10106713
- E1610S_v1_10127485
- E1610S_v1_10141843
- E1610S_v1_10155959
- E1610S_v1_10166226
- E1610S_v1_10182782
- E1610S_v1_0021804
- E1610S_v1_10242808
- E1610S_v1_10266028
- E1610S_v1_10294764
- E1610S_v1_10309032
-
Safety Data Sheets
The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely. -
Legal and Disclaimers
Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.Licenses
N6-Methyladenosine Antibody is produced by Cell Signaling Technology, Inc. and sold by New England Biolabs, Inc.Trademarks
NEW ENGLAND BIOLABS®, NEBNEXT®, EPIMARK® and PROTOSCRIPT® are registered trademarks of New England Biolabs, Inc.
ULTRA™ is a trademark of New England Biolabs, Inc.
ILLUMINA® is a registered trademark of Illumina, Inc.
EPPENDORF® is a registered trademark of Sigma, Inc.
iTAQ™ is a trademark of Bio-Rad Laboratories, Inc.
SYBR® and DYNABEADS® are registered trademarks of Life Technologies Corporation.
MYONE™ is a trademark of Life Technologies Corporation.
-
Featured Videos
Other Products You May Be Interested In
No supporting documents available
This product has no supporting documents available for download. If you feel like supporting documents should be available for this product, please contact us.