Product Class: Restriction Endonuclease

PI-SceI
NEBU recombinant dil_B 37 65 Heat ralbumin

The large size of this product was discontinued on 12/31/2020. The small size will continue to be available.

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing
Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence ATCTATGTCGG_GTGC^GGAGAAAGAGGTAAT

Product Introduction

  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG (-22/-26)
Catalog # Size Concentration
R0696S 250 units 5000 units/ml
R0696L 1250 units 5000 units/ml

Product Information

Description

The intein encoding PI-SceI is present in the VMA ATPase gene Saccharomyces cerevisiae (1,5). The gene has been modified for independent expression in E. coli using a T7 RNA polymerase expression system (2).

Product Source

An E. coli strain that carries the VMA1 ATPase gene from Saccharomyces cerevisiae (J. Thorner).
This product is related to the following categories:
Homing Endonucleases,
Restriction Endonucleases P R,
This product can be used in the following applications:
Restriction Enzyme Digestion

Reagents Supplied

Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration

Properties & Usage

Unit Definition

One unit is defined as the amount of enzyme required to cleave 1 μg of pBSvdeX XmnI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 μl.

Reaction Conditions

1X NEBuffer™ PI-SceI
Supplement with Recombinant Albumin, Molecular Biology Grade
Incubate at 37°C

1X NEBuffer™ PI-SceI
10 mM MgCl2
1 mM DTT
10 mM Tris-HCl
100 mM KCl
(pH 8.6 @ 25°C)

Activity in NEBuffers

NEBuffer™ r1.1: 10%
NEBuffer™ r2.1: 10%
NEBuffer™ r3.1: 10%
rCutSmart™ Buffer: 10%

Diluent Compatibility

Storage Buffer

10 mM Tris-HCl
1 mM DTT
0.1 mM EDTA
500 µg/ml BSA
50% Glycerol
300 mM NaCl
pH 7.4 @ 25°C

Heat Inactivation

65°C for 20 minutes

Product Notes

  1. Supplied with plasmid DNA: XmnI-linearized pBSvdeX is supplied 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.7 kb plasmid with PI-SceI gives fragments of 2550 and 1150 base pairs Enzyme Properties
  2. Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
  3. PI-SceI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
  4. Supplement with supplied vial of Recombinant Albumin (rAlbumin) to 100 µg/ml.

Protocols, Manuals & Usage

Protocols

  1. Restriction Digest Protocol
  2. Optimizing Restriction Endonuclease Reactions
  3. Double Digest Protocol with Standard Restriction Enzymes

Usage & Guidelines

Tools & Resources

Selection Charts

Web Tools

FAQs & Troubleshooting

FAQs

  1. Can a double digest be performed with PI-SceI and I-CeuI?
  2. Can you tell me more about the switch from BSA to Recombinant Albumin (rAlbumin) in NEBuffers?

Troubleshooting

Tech Tips

PI-SceI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.