PI-SceI
Product informationCode | Name | Size | Quantity | Price | ||||
---|---|---|---|---|---|---|---|---|
R0696S |
PI-SceI (VDE), recombinant |
250 units ( 5000 units/ml ) |
|
€ 90.00 |
+
|
PI-SceI
The large size of this product was discontinued on 12/31/2020. The small size will continue to be available.
Product Introduction
- This is a homing endonuclease and requires 3 hour incubation periods
- Tolerates some sequence degeneracy within recognition sequence
- Restriction Enzyme Cut Site: ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG (-22/-26)
Catalog # | Size | Concentration |
---|---|---|
R0696S | 250 units | 5000 units/ml |
Featured Videos
View Video Library-
Reduce Star Activity with High-Fidelity Restriction Enzymes
-
Standard Protocol for Restriction Enzyme Digests
-
NEB® TV Ep. 15 – Applications of Restriction Enzymes
-
Restriction Enzyme Digest Protocol: Cutting Close to DNA End
-
Restriction Enzyme Digestion Problem: DNA Smear on Agarose Gel
-
Why is My Restriction Enzyme Not Cutting DNA?
-
Restriction Enzyme Digest Problem: Too Many DNA Bands
-
Double Digestion with NEBcloner
- Product Information
- Protocols, Manuals & Usage
- Tools & Resources
- FAQs & Troubleshooting
- Citations & Technical Literature
- Quality, Safety & Legal
- Other Products You May Be Interested In
Product Information
Description
The intein encoding PI-SceI is present in the VMA ATPase gene Saccharomyces cerevisiae (1,5). The gene has been modified for independent expression in E. coli using a T7 RNA polymerase expression system (2).Product Source
An E. coli strain that carries the VMA1 ATPase gene from Saccharomyces cerevisiae (J. Thorner).- This product is related to the following categories:
- Homing Endonucleases,
- Restriction Endonucleases P R,
- This product can be used in the following applications:
- Restriction Enzyme Digestion
Reagents Supplied
Reagents Supplied
The following reagents are supplied with this product:
NEB # | Component Name | Component # | Stored at (°C) | Amount | Concentration | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Properties & Usage
Unit Definition
One unit is defined as the amount of enzyme required to cleave 1 μg of pBSvdeX XmnI-linearized Control Plasmid in 3 hours at 37°C in a total reaction volume of 50 μl.Reaction Conditions
1X NEBuffer™ PI-SceI
Supplement with Recombinant Albumin, Molecular Biology Grade
Incubate at 37°C
1X NEBuffer™ PI-SceI
10 mM MgCl2
1 mM DTT
10 mM Tris-HCl
100 mM KCl
(pH 8.6 @ 25°C)
Activity in NEBuffers
NEBuffer™ r1.1: 10%NEBuffer™ r2.1: 10%
NEBuffer™ r3.1: 10%
rCutSmart™ Buffer: 10%
Diluent Compatibility
Storage Buffer
10 mM Tris-HCl
1 mM DTT
0.1 mM EDTA
500 µg/ml BSA
50% Glycerol
300 mM NaCl
pH 7.4 @ 25°C
Heat Inactivation
65°C for 20 minutesRelated Products
Materials Sold Separately
Product Notes
- Supplied with plasmid DNA: XmnI-linearized pBSvdeX is supplied 0.5 mg/ml in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. Cleavage of this 3.7 kb plasmid with PI-SceI gives fragments of 2550 and 1150 base pairs Enzyme Properties
- Homing endonucleases do not have stringently-defined recognition sequences in the way that restriction enzymes do. That is, single base changes do not abolish cleavage but reduce its efficiency to variable extents. The precise boundary of required bases is generally not known. The recognition sequence listed is one site that is known to be recognized and cleaved.
- PI-SceI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.
- Supplement with supplied vial of Recombinant Albumin (rAlbumin) to 100 µg/ml.
Protocols, Manuals & Usage
Protocols
Usage & Guidelines
- Activity at 37°C for Restriction Enzymes with Alternate Incubation Temperatures
- Activity of Restriction Enzymes in PCR Buffers
- Cleavage Close to the End of DNA Fragments
- Digestion of Agarose-Embedded DNA: Info for Specific Enzymes
- Double Digests
- Heat Inactivation
- NEBuffer Activity/Performance Chart with Restriction Enzymes
- Optimizing Restriction Endonuclease Reactions
- Restriction Endonucleases - Survival in a Reaction
- Restriction Enzyme Diluent Buffer Compatibility
- Restriction Enzyme Tips
- Single Letter Codes
- Star Activity
- Traditional Cloning Quick Guide
Tools & Resources
Selection Charts
Web Tools
FAQs & Troubleshooting
FAQs
Troubleshooting
Tech Tips
Citations & Technical Literature
Citations
Additional Citations
Quality, Safety & Legal
Quality Assurance Statement
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.Specifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]Certificate Of Analysis
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]- R0696S_L_v1_0013102
- R0696S_L_v2_0131302
- R0696S_L_v2_0131312
- R0696S_L_v1_0121302
- R0696S_L_v1_0121306
- R0696S_L_v1_0121405
- R0696S_L_v2_0131411
- R0696S_L_v2_0131505
- R0696S_L_v2_0131406
- R0696S_L_v2_0131510
- R0696S_L_v2_0131601
- R0696S_L_v2_0131609
- R0696S_L_v2_0131703
- R0696S_L_v2_0131708
- R0696S_L_v2_0131802
- R0696S_v2_10022517
- R0696L_v2_10028304
- R0696S_v2_10027190
- R0696L_v2_10039628
- R0696L_v2_10042578
- R0696S_v2_10039626
- R0696S_v2_10054272
- R0696S_v2_10056027
- R0696S_v2_10057941
- R0696L_v2_10056029
- R0696S_v2_10074532
- R0696L_v2_10082396
- R0696S_v2_10086384
- R0696S_v2_10105802
- R0696S_v2_10117695
- R0696S_v2_10154978
- R0696S_v2_10158555
- R0696S_v2_10181280
- R0696S_v2_10182454
- R0696S_v2_10207816
- R0696S_v2_10225914
- R0696S_v2_10308563
Safety DataSheets
The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.PI-SceI
Recombinant Albumin, Molecular Biology Grade
pBSvdeX XmnI-linearized Control Plasmid
Legal and Disclaimers
Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.
Other Products You May Be Interested In
The supporting documents available for this product can be downloaded below.